Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuA1

[Submit comment/correction]

Locus	XksuA1
Type	RFLP
Chromosome	5B 7D
Chromosome Arm	7DS
Map	Ta-Physical-Gill-5D 0.9 Ta-Physical-Gill-7ABD -81 Wheat-Composite2004-5B 55
	[ Show Nearby Loci ]
Breakpoint Interval	Cent/5DL-7 7S-0.61-1.00
Map Data	Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuA1
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	A001 [ Show all 24 ]
Probe for Locus	pTtksuA1
Locus	Xksu-A1 [ Show all 26 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGATTGTCAACAAGTGCC L:CAACAGAGATATTGCCGTAG
Polymorphism	KSUA1 DraI KSUA1 XbaI KSUA1 EcoRI KSUA1 EcoRV KSUA1 HindIII
Linkage Group	7D / 7DS Barley 1 (7H)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.2