Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuE11-1A.1

[Submit comment/correction]

Locus	XksuE11-1A.1
Type	RFLP
Chromosome	1A
Chromosome Arm	1AL
Map	Ta-Synthetic/Opata-1A 159.1 Ta-Synthetic/Opata-BARC-1A 120.6 Ta-Synthetic/Opata-GPW-1A 170.4
	[ Show Nearby Loci ]
Map Data	Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, GPW
Probe	pTtksuE11
Image	KSUE11 SO autoradiogram
Possible Orthologs	E011 [ Show all 18 ]
Probe for Locus	pTtksuE11
Locus	XksuE11-1 [ Show all 21 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CTGTCACTGCTTCCATAACT L:AAGAAAAGCCTTCAAGACTT
Polymorphism	KSUE11 DraI
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	2.1