Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuE8

[Submit comment/correction]

Locus	XksuE8
Type	RFLP
Chromosome	1A 1D 1R
Chromosome Arm	1AL 1BL 1DL 1RL
Map	Secale-Devos-1R 17 [ Show all 8 ]
	[ Show Nearby Loci ]
Breakpoint Interval	1DL-5/0 1L-0.66-0.70
Map Data	Rye, Ds2 x RxL10 [ Show all 7 ]
Species	Triticum aestivum
Probe	pTtksuE8
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	E008 [ Show all 9 ]
Probe for Locus	pTtksuE8
Locus	XksuE8-1 [ Show all 10 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TATGGGCCAGTGATTTCCAC L:TGCTCGGTTCAATTGACTGC
Specificity	Primer specificity verified, maps on chromosomes 1BL, 1DL.
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.8