Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF15

[Submit comment/correction]

Locus	XksuF15
Type	RFLP
Chromosome	2B 2D
Chromosome Arm	2DL
Map	Ta-Physical-Gill-2ABD 73 Ta-Physical-Gill-2D 3.58 Wheat-Composite2004-2B 88
	[ Show Nearby Loci ]
Breakpoint Interval	2DL-8/2DL-9 2L-0.70-0.76
Map Data	Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuF15
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	F015 [ Show all 6 ]
Probe for Locus	pTtksuF15
Locus	ksuF15A [ Show all 8 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AAGGTGGAAGTATGGTGCTA L:AAGAAGAGGAGAAAACAGAC
Polymorphism	KSUF15 EcoRI
Linkage Group	2D 2
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.8