Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF41

[Submit comment/correction]

Locus	XksuF41
Type	RFLP
Chromosome	2A 2B 2D 2R
Chromosome Arm	2DL 2RL
Map	Rye-2009-Consensus-2R 47.4 [ Show all 6 ]
	[ Show Nearby Loci ]
Breakpoint Interval	2DL-9/0 2L-0.89-1.00
Map Data	Rye, P87 x P105, update Rye_2009_consensus Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuF41
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	F041 [ Show all 11 ]
Probe for Locus	pTtksuF41
Locus	XksuF41-2 [ Show all 13 ]
Type	Genomic STS
PCR primers	R:TCTCCTAGCATAGCAGATGG L:AGTCGTGTCGACTCGTCCAA
Polymorphism	KSUF41 EcoRV [ Show all 6 ]
Linkage Group	2D / 2D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.9