Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG34

[Submit comment/correction]

Locus	XksuG34
Type	RFLP
Chromosome	1A 1B 1D
Chromosome Arm	1AL 1DL
Map	Ta-Dubcovsky-1A 45.2 [ Show all 7 ]
	[ Show Nearby Loci ]
Breakpoint Interval	1L-0.85-0.87
Map Data	T. monococcum, DV92 x G3116 [ Show all 6 ]
Species	Triticum aestivum
Probe	pTtksuG34
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	G034 XksuG34-1 XksuG34-1B XksuG34-1D
Probe for Locus	pTtksuG34
Locus	XksuG34-1 [ Show all 14 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GTCTCAGGAAGGTGATGATC L:GAGCAGTAGGGTAAAGTAAG
Amplification Conditions	Anneal at 45oC
Polymorphism	KSUG34 EcoRI
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Source Tissue	leaf
Insert Size	0.9