Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG48-6A

[Submit comment/correction]

Locus	XksuG48-6A
Type	RFLP
Chromosome	6A
Chromosome Arm	6AS
Map	Ta-Courtot/CS-GPW-6A 26.1 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	T. turgidum, durum x dicoccoides [ Show all 8 ]
Species	Triticum turgidum
Probe	pTtksuG48 Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Image	KSUG48 SO autoradiogram
Reference	Chen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.
Possible Orthologs	G048a [ Show all 13 ]
Probe for Locus	pTtksuG48
Locus	XksuG48-6B [ Show all 14 ]
Synonym	Other name DG G48 Ma Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CGGTAGGGCTCGTGCTCACC L:AGGGAGGCTCGCTGGTTTTT
Polymorphism	KSUG48 EcoRV
Linkage Group	6D, 3D (2)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6