Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG53

[Submit comment/correction]

Locus	XksuG53
Type	RFLP
Chromosome	3B 3D 3R
Chromosome Arm	3DS 3RS
Map	Rye-2009-Consensus-3R 61.8 [ Show all 7 ]
	[ Show Nearby Loci ]
Breakpoint Interval	0/3DS-1 3S-0.39-1.00
Map Data	Rye, Ds2 x RxL10 [ Show all 6 ]
Species	Triticum aestivum
Probe	pTtksuG53
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	G053 [ Show all 10 ]
Probe for Locus	pTtksuG53
Locus	XksuG53-3 [ Show all 15 ]
Type	Genomic STS
PCR primers	R:CCAAATGACACAAACAACAT L:GCTGGCAGAGAGAGATTGAG
Polymorphism	KSUG53 EcoRI
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.1