Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG62

[Submit comment/correction]

Locus	XksuG62
Type	RFLP
Chromosome	3B 3D 3R
Chromosome Arm	3DL 3RL
Map	Secale-PxP-update-3R 102.4 Ta-Physical-Gill-3ABD 89 Ta-Physical-Gill-3D 2.94 Tm-Dubcovsky2-3A 41.6 Wheat-Composite2004-3B 60
	[ Show Nearby Loci ]
Breakpoint Interval	3DL-2/0 3L-0.78-1.00
Map Data	Rye, P87 x P105, update T. monococcum, DV92 x G3116 Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuG62
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	G062a [ Show all 12 ]
Probe for Locus	pTtksuG62
Locus	ksuG62 [ Show all 15 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	L:TTAGAAGCAGGCTATGACCA R:TACCATCAAGACGCCAGAAG
Linkage Group	3D (9)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.7