Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg584-3A

[Submit comment/correction]

Locus	Xmwg584-3A
Type	RFLP
Map	Tm-Dubcovsky2-3A -9.8
	[ Show Nearby Loci ]
Map Data	T. monococcum, DV92 x G3116
Probe	MWG584
Remark	In the population 'T. monococcum, DV92 x G3116,' this locus and Xabg460-3A were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous. Segregation data are listed under Xabg460-3A.
Possible Orthologs	MWG584 Xmwg584 Xmwg584-3 Xmwg584-4A.1 Xmwg584-4A.2
Probe for Locus	MWG584
Locus	Xmwg584-3 [ Show all 6 ]
Synonym	Synonym HAR35_23373 HAR35_30482
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	Restriction Enzyme for CAPS marker is Stu I
Type	Genomic STS
PCR primers	5' aaggcaagattggacgaggttt 3' 5' aaggcaagattggacgaggttt 3' 5' ttggaggagagcggaagagat 3' 5' ttggaggagagcggaagagat 3'
STS primers	5' GTATTCTTGGAGGAGAGCGG 5' CGAGGTTTACCCTGGAGACG
STS size	365
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234524 AJ234523 MWG584-5 MWG584-3
Linkage Group	3H
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.9