Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg60-1D

[Submit comment/correction]

Locus	Xmwg60-1D
Type	RFLP
Chromosome	1D
Chromosome Arm	1DS
Map	1DS, Ae. tauschii 24.9 Ta-Synthetic/Opata-GPW-1D 21.8
	[ Show Nearby Loci ]
Map Data	1DS, Ae. tauschii Wheat, Synthetic x Opata, GPW
Species	Aegilops tauschii
Probe	MWG60
Reference	Spielmeyer W et al. (2000) NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat Theoretical and Applied Genetics 101:1139-1144.
Possible Orthologs	mwg060 [ Show all 7 ]
Probe for Locus	MWG60
Locus	Xmwg060 [ Show all 11 ]
General Remarks	single - low copy probe
Type	Genomic PCR STS
PCR primers	R:CTGGATAGAGAAGCCATGGA L:CAACGATACAACAGGCTCAA
Amplification Conditions	Anneal at 45oC.
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.3