Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg934-6R

[Submit comment/correction]

Locus	Xmwg934-6R
Type	RFLP
Chromosome	6R
Map	Secale-N6xN2-2004-6R 96.9 Secale-N7xN6-2004-6R 82.1 Secale-PxP-2004-6R 63.6
	[ Show Nearby Loci ]
Map Data	Rye, N6 x N2, 2004 Rye, N7 x N6, 2004 Rye, P87 x P105, 2004
Species	Secale cereale
Probe	MWG934
Reference	Khlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.
Possible Orthologs	MWG934 [ Show all 12 ]
Probe for Locus	MWG934
Locus	Xmwg934-6 [ Show all 13 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' GTGTCGTCCAGGTAGTACTT 5' CCGGCACCACCAACTTTGAA
STS size	314
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234657 AJ234656 MWG934-5 MWG934-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare