Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg949-2R

[Submit comment/correction]

Locus	Xmwg949-2R
Type	RFLP
Chromosome	2R
Map	Secale-N6xN2-2004-2R 129.8 Secale-N7xN6-2004-2R 136.6 Secale-PxP-2004-2R 174.8
	[ Show Nearby Loci ]
Map Data	Rye, N6 x N2, 2004 Rye, N7 x N6, 2004 Rye, P87 x P105, 2004
Species	Secale cereale
Probe	MWG949
Reference	Khlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.
Possible Orthologs	MWG949 MWG949A MWG949a-2H MWG949B Xmwg949
Probe for Locus	MWG949
Locus	MWG949 [ Show all 6 ]
Synonym	Synonym HAR35_19354
General Remarks	MWG949 comes from a digest of MWG950 plasmid DNA and excising the 1.8 kb fragment.
Type	Genomic STS
STS primers	5' CGGCTGGTAAATGAACTGAA 5' GGCTTCCGCTACTACGTCTT
STS size	ca. 1800
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234667 AJ234666 MWG949-5 MWG949-3
Linkage Group	2
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.8