Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xpsp3003-1A

[Submit comment/correction]

Locus	Xpsp3003-1A
Type	Microsatellite
Chromosome	1A
Chromosome Arm	1AL
Map	CS/SQ1-1A 56.5 Ta-Gale-1A 4
	[ Show Nearby Loci ]
Map Data	Wheat, Chinese Spring x SQ1 Wheat, Gale
Probe	PSP3003
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
Remark	Quality score = 4 (multiple products and multiple loci, easy to score but sometimes difficult to relate polymrphic loci to those previously characterized and mapped)
Probe for Locus	PSP3003
Locus	Xpsp3003-1A [ Show all 6 ]
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949. Bryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
General Remarks	Insert contains repeat (CA)15
Type	PCR SSR
PCR primers	Forward GATCGACAAGGCTCTAATGC Reverse CAGGAGGAGAGCCTCTTGG
SSR size	210, 7D locus
Amplification Conditions	63C anneal
Sequence	PSP3003
Source Species	Triticum aestivum