Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xpsp3029-2A

[Submit comment/correction]

Locus	Xpsp3029-2A
Type	Microsatellite
Chromosome	2A
Chromosome Arm	2AL
Map	Ta-Gale-2A 24
	[ Show Nearby Loci ]
Map Data	Wheat, Gale
Probe	PSP3029
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
Remark	Quality score = 4 (multiple products and multiple loci, easy to score but sometimes difficult to relate polymrphic loci to those previously characterized and mapped)
Probe for Locus	PSP3029
Locus	Xpsp3029.1-6A [ Show all 6 ]
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949. Bryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
General Remarks	Insert contains repeat (AG)21
Type	PCR SSR
PCR primers	Forward CCATCGATGAGGATCTCCTCGGGCA Reverse GCAACAGGACCATGGTCG
SSR size	150, 2A locus
Amplification Conditions	58/61C anneal
Sequence	PSP3029
Source Species	Triticum aestivum