Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xpsp3047-3A

[Submit comment/correction]

Locus	Xpsp3047-3A
Type	Microsatellite
Chromosome	3A
Chromosome Arm	3AL
Map	CS/SQ1-3A 73.3 Ta-Courtot/CS-GPW-3A 86.4 Ta-Gale-3A 0.75
	[ Show Nearby Loci ]
Map Data	Wheat, Chinese Spring x SQ1 Wheat, Courtot x Chinese Spring, GPW Wheat, Gale
Probe	PSP3047 PSP3047_3A
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
Remark	Quality score = 2 (single product recognizing a single locus, some stuttering however easy to score)
Probe for Locus	PSP3047
Locus	Xpsp3047-3A Xpsp3047
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949. Bryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
General Remarks	Insert contains repeat (TC)18(TC)9 (imperfect)
Type	PCR SSR
PCR primers	Forward CCGTTCATAGGCCAATTTCG Reverse TCTGCAACATTCCCCAACAG
SSR size	184, 3A locus
Amplification Conditions	61C anneal
Sequence	PSP3047
Source Species	Triticum aestivum