Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xpsp3151-1A

[Submit comment/correction]

Locus	Xpsp3151-1A
Type	Microsatellite
Chromosome	1A
Chromosome Arm	1AS
Map	CS/SQ1-1A 26.5 Ta-Courtot/CS-GPW-1A 27.3 Ta-Gale-1A -2.9
	[ Show Nearby Loci ]
Map Data	Wheat, Chinese Spring x SQ1 Wheat, Courtot x Chinese Spring, GPW Wheat, Gale
Probe	PSP3151
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
Remark	Quality score = 3 (single locus, profound and/or irregular stuttering, sometimes difficult to score)
Probe for Locus	PSP3151
Locus	Xpsp3151-1A Xpsp3151
Reference	Stephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949. Bryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
General Remarks	Insert contains repeat (TG)28
Type	PCR SSR
PCR primers	Forward GGCTGGTGTAGTAGGTTGCGA Reverse CGCAACACCATATCATGTGTCAA
SSR size	139, 1A locus
Amplification Conditions	61C anneal
Sequence	PSP3151
Source Species	Triticum aestivum