Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG720

[Submit comment/correction]

Locus	cMWG720
Type	RFLP
Synonym	Synonym cMWG720
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-Consensus-2H 76.6 [ Show all 20 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 20 ]
Probe	cMWG720
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of cMWG720 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs	cMWG720-2H Xcmwg720 Xcmwg720-2
Probe	cMWG720
Locus	Xcmwg720-2 cMWG720 Xcmwg720 cMWG720-2H
Synonym	Synonym HAR35_2436 HAR35_2437
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CTCTGGAAGTTGTCGCTTCTCAGC 5' GACTTCTTGACACGATCATT
STS size	193
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234437 CMWG720-5
Linkage Group	2H
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	0.5