Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG773

[Submit comment/correction]

Locus	cMWG773
Type	RFLP
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-Consensus-7H -38.7 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	cMWG773
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG773-7H
Probe	cMWG773
Locus	cMWG773 cMWG773-7H
Synonym	Other name MWG773 Kunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27. Synonym HAR35_11092 HAR35_19559 HAR35_6484
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' TGCCCAATTAACCATGAACC 5' TCAGGCTCTGAATGAATCTCG
STS size	228
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234451 CMWG773-5
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf