Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k00345

[Submit comment/correction]

Locus	k00345
Type	CAPS Indel
Chromosome	2H
Map	Hv-HNxH602-2H 352.7 Hv-Integrated2009-2H 146.7
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	baak24m01 k00345
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	Codominant size polymorphism Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada
Probe for Locus	baak24m01
Locus	k00345
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = Pri [Erwinia amylovora]
Type	PCR
PCR primers	Left 5' - TTCCTTCCGTCTGCTCAACT Right 5' - TGATGTTCTTCGTGGTTGGA
Sequence	BJ462323
PCR size	410