Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k02536

[Submit comment/correction]

Locus	k02536
Type	CAPS Indel
Chromosome	5H
Map	Hv-HNxH602-5H 1 Hv-Integrated2009-5H 3.2
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	bags22c02 k02536
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	Codominant size polymorphism Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada
Probe for Locus	bags22c02
Locus	k02536
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = Yippee-like protein dbj BAC23053.1 yippee-like protein [Solanum tuberosum]
Type	PCR
PCR primers	Left 5' - TGTACATCAACGTACAACCGTG Right 5' - TCAGAGATCCAGCACATTCG
Sequence	AV918754
PCR size	363