Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k04002

[Submit comment/correction]

Locus	k04002
Type	CAPS Indel
Chromosome	2H
Map	Hv-HNxH602-2H 190.8 Hv-Integrated2009-2H 91.8
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	bah32c06 k04002
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	Codominant size polymorphism Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada
Probe for Locus	bah32c06
Locus	k04002
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = OSJNBa0008M17.11 [Oryza sativa (japonica cultivar-group)]
Type	PCR
PCR primers	Left 5' - GACACCACATCCACAAACGA Right 5' - GCGACCACAAGGAGAAGAAG
Sequence	BJ486265
PCR size	428