Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuA3A

[Submit comment/correction]

Locus	ksuA3A
Type	RFLP
Synonym	Synonym pTtksuA3
Chromosome	5H
Map	Barley-Consensus2-5H 55.7 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QCww.StMo-5H
Map Data	Barley consensus 2 [ Show all 13 ]
Probe	pTtksuA3
Reference	Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Number of populations contributing to the placement of ksuA3A in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	A003 [ Show all 6 ]
Probe for Locus	pTtksuA3
Locus	DGA3 [ Show all 17 ]
Type	Genomic STS
PCR primers	R:GTATTATGGTCCATGTCTAC L:AACATGGTCCTCAGGGAATC
Specificity	Primer specificity verified, maps on chromosome 5D.
Linkage Group	5D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.4