Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuD14

[Submit comment/correction]

Locus	ksuD14
Type	RFLP
Chromosome	1H
Chromosome Arm	1HS
Map	Barley-Consensus-1H -36.5 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	pTtksuD14
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of ksuD14 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	D014 [ Show all 26 ]
Probe for Locus	pTtksuD14
Locus	ksuD14F [ Show all 28 ]
Type	Genomic STS
PCR primers	R:CCAAAGAGCATCCATGGTGT L:CGCTTTTACCGAGATTGGTC
Specificity	Primer specificity verified, maps on chromosome 1BS.
Polymorphism	KSUD14 EcoRV
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6