Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuE2B

[Submit comment/correction]

Locus	ksuE2B
Type	RFLP
Map	Hordeum-Bins-1H 127
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005
Probe	pTtksuE2
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	E002 [ Show all 10 ]
Probe for Locus	pTtksuE2
Locus	XksuE2-4B [ Show all 12 ]
Type	Genomic STS
PCR primers	R:CTGATTTAGTCCTGTGGCAC L:GTATTTCTACCATGGCTAGC
Specificity	Primer specificity verified, maps on chromosome 3BS.
Polymorphism	KSUE2 DraI
Linkage Group	3D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.5