Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuF2

[Submit comment/correction]

Locus	ksuF2
Type	RFLP
Chromosome	2H
Map	Hordeum-Bins-6H 88 Hordeum-Consensus2006-DArT-2H 98.2
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Barley, Consensus 2006, DArT
Probe	pTtksuF2
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of ksuF2 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	F002a [ Show all 16 ]
Probe for Locus	pTtksuF2
Locus	ksuF2A [ Show all 22 ]
Type	Genomic STS
PCR primers	R:TTCGCCATTAGAGCAACCTG L:GGAGATGGATTCCCTTGTCC
Polymorphism	KSUF2 DraI
Linkage Group	2D / 7D (5)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.3