Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuF2A

[Submit comment/correction]

Locus	ksuF2A
Type	RFLP
Synonym	Synonym pTtksuF2
Chromosome	1H
Map	Barley-Consensus2-1H 73.6 [ Show all 11 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 11 ]
Probe	pTtksuF2
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	F002a [ Show all 16 ]
Probe for Locus	pTtksuF2
Locus	ksuF2A [ Show all 22 ]
Type	Genomic STS
PCR primers	R:TTCGCCATTAGAGCAACCTG L:GGAGATGGATTCCCTTGTCC
Polymorphism	KSUF2 DraI
Linkage Group	2D / 7D (5)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.3