Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuH16

[Submit comment/correction]

Locus	ksuH16
Type	RFLP
Map	Hordeum-Bins-2H 169 Wheat, Yr genes and QTL 2D 77.3
	[ Show Nearby Loci ]
Map Data	Barley, BinMap 2005 Wheat, Yr genes and QTL
Probe	pTtksuH16
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	H016 [ Show all 7 ]
Probe for Locus	pTtksuH16
Locus	XksuH16 [ Show all 10 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CACCTTCTTCTTCTTCTACT L:ACACTCTTCATTGGCATCTC
Polymorphism	KSUH16 EcoRV [ Show all 6 ]
Linkage Group	2D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.4