Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: mlRd30

[Submit comment/correction]

Locus	mlRd30
Type	Trait
Chromosome	7A
Chromosome Arm	7AL
Map	Wheat-Composite2004-7A 75
	[ Show Nearby Loci ]
Species	Triticum aestivum
Probe	pTtksuH9
Associated Gene	mlRd30 (Triticum)
Gene Class	Reaction to Erysiphe graminis DC.
Reference	Singrun C et al. (2004) Localization of a novel recessive powdery mildew resistance gene from common wheat line RD30 in the terminal region of chromosome 7AL Theoretical and Applied Genetics 109:210-214.
Remark	Trait marker Xksuh9-7A Nearby marker on Composite map: XksuH9 Position on Composite map estimated by GrainGenes.
Probe for Locus	pTtksuH9
Locus	XksuH9 [ Show all 27 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GTGTATCACAAGCTTGCTGT L:ATTGACCATTGCCCGGAGAA
Specificity	Primer specificity verified, maps on chromosome 2DL.
Polymorphism	KSUH9 HindIII
Linkage Group	2D, 1D (4)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5