Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scind00149

[Submit comment/correction]

Locus	scind00149
Type	Indel Microsatellite
Synonym	Other name Best6800 Synonym ABC00149_L01R01
Chromosome	7H
Map	Barley, B73xCPI-7H 87 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	ABC00149_L01R01 scind00149
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC00149_L01R01
Locus	scind00149
Data at Germinate	ABC00149
Data at PLEXdb	Barley1_00149
General Remarks	Estimated product size = unknown BarleySNP type = EST Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc00149
Type	STS
PCR primers	5' TTGTGGGGTTTTACCTGTGA 5' ACAAACCAACCGAGCAGAAT
Sequence	Barley1_00149
Source Species	Hordeum vulgare