Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scind04312

[Submit comment/correction]

Locus	scind04312
Type	Microsatellite
Map	Barley, B73xCPI-4H 56.3
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI
Probe	scind04312
Probe	scind04312
Locus	scind04312
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type	Indel
PCR primers	CCTCCATGAAACCCTTCCTT GTGGAGTGGGTCCTCAAGAA