Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp06144

[Submit comment/correction]

Locus	scsnp06144
Type	SNP
Synonym	Other name SNP86 Synonym ABC06144_L01R01
Chromosome	5H
Map	Hordeum-Consensus2005-SNP-5H 89.665 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	ABC06144_L01R01
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC06144_L01R01
Locus	scsnp06144
Data at Germinate	ABC06144
Data at PLEXdb	Barley1_06144
General Remarks	Estimated product size = 152 BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc06144
Type	STS
PCR primers	5' TTGCAAACAATTGTACCAGATG 5' CCTTGTGCCTTAGGGTTCAG
Sequence	Barley1_06144
Source Species	Hordeum vulgare