Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp14681

Locus	scsnp14681
Type	SNP
Chromosome	6H
Map	Hordeum-Consensus2005-SNP-6H 69.719 Hordeum-OWB-SNP-6H 71.67 Hordeum-QTLConsensus-Abiotic-6H 69.72 Hordeum-QTLConsensus-Agronomic-6H 69.72
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, OWB, SNP
Probe	ABC14681
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe for Locus	ABC14681
Locus	scsnp14681
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
PCR primers	TTGCCGTTGGAGAGTAATTTTGAC CAGGCGCGAGATCGAACAC