Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp21226

[Submit comment/correction]

Locus	scsnp21226
Type	SNP
Synonym	Other name SNP2332 Synonym ABC21226_L01R01
Chromosome	6H
Map	Hordeum-Consensus2005-SNP-6H 93.176 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	ABC21226_L01R01
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC21226_L01R01
Locus	scsnp21226
Data at Germinate	ABC21226
General Remarks	Estimated product size = unknown BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc21226
Type	STS
PCR primers	5' GCCCTTTCGCCCTACTACAT 5' CCTGCGGGTAATACCATTTC
Source Species	Hordeum vulgare