Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Dhn6

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Dhn6  [ Marker Report ]
Locus	Dhn6 Dhn6-4H
Synonym	Other name HV2
Reference	Choi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354. Kleinhofs A (1992) The NABGMP mapping progress report, spring 1992 Barley Genetics Newsletter 21:38-48.
General Remarks	Size in Dicktoo (bp) = 976 Size in Morex (bp) = 517 dehydrin
Type	Genomic PCR STS
PCR primers	5' CAATCCGTGAAGCGAAGAGATGG 3' ACCAGGCCATGTCACAGTACTGC
Amplification Conditions	Annealing temp. = 62
Sequence	AF181456
Linkage Group	Group 4
Source Species	Hordeum vulgare
Insert Size	1.8