Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: EC

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	EC
Synonym	Other name X68288
Reference	Kawashima I et al. (1992) Wheat Ec metallothionein genes. Like mammalian Zn2+ metallothionein genes, wheat Zn2+ metallothionein genes are conspicuously expressed during embryogenesis European Journal of Biochemistry 209:971-976.
General Remarks	Primers designed from wheat EC protein gene.
Type	PCR STS
PCR primers	R:GAATTCATGGGTCGCCGACA L:AGCAAGGCACGCCGGAGATC
Amplification Conditions	Anneal at 50oC.
Sequence	X68288
Linkage Group	Fragment amplified by primers mapped to 3D.
Source Species	Triticum aestivum
Source Germplasm	Yamhill Variety
PCR size	0.881