Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: GBM1232

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	GBM1232  [ Marker Report ]
Locus	GBM1232 GBM1232-2H
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Varshney RK et al. (2006) Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome Theoretical and Applied Genetics 113:239-250.
General Remarks	Clone HH01F06u
Type	SSR
PCR primers	TTGGTTCTAGCCACACCTAAAA GTTTTCGTCACACGTCCCTT
Amplification Conditions	3 min at 94 deg C; 45 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C (touchdown of 0.5 deg C / cycle for initial 10 cycles - final annealing of 55 deg C for remaining 35 cycles), 30 sec at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	CB863094
DNA Library	IPK-HH
Source Species	Hordeum vulgare
Source Germplasm	Sloop (barley)