Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AY244510/1

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AY244510/1  [ Marker Report ]
Locus	CYS
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Type	Genomic STS
PCR primers	CYS-F TCATGGACAACGCCTTCGAGT CYS-R CCAACAGGTTCGCCGACCTC
Sequence	AY244511 AY244510
Source Gene Class	Cysteine proteinase
Source Gene	Cys-A1 (Triticum)
Source Species	Triticum monococcum