Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AY244514

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AY244514  [ Marker Report ]
Locus	PHY-C
Reference	Yan L et al. (2003) Positional cloning of the wheat vernalization gene VRN1 Proceedings of the National Academy of Sciences, USA 100:6263-6268.
Type	Genomic STS
PCR primers	PHY-C-F GAAAATGTCTGAACAAGCTGCT PHY-C-R TCTAGATGAGCAATCTGCAT
STS size	0.750
Sequence	AY244514
Source Gene Class	Phytochrome C
Source Gene	PhyC-A1 (Triticum)
Source Species	Triticum monococcum
Source Germplasm	T. monococcum L. ssp. aegilopoides G1777