Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: HV02287

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	HV02287  [ Marker Report ]
Locus	HV02287
General Remarks	Insert contains repeat (ac)7
Type	PCR STS
PCR primers	5' tcgatcgcatgacgatcgagc 3' tggtggccgccatggcaacca
Amplification Conditions	35 cycles at 94, 50, 72 C
Source Gene Class	Chitinase
Source Species	Hordeum vulgare