Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: HvKNOX3

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	HvKNOX3  [ Marker Report ]
Locus	HvKNOX3
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Pillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (t)14 Polymorphic Information Content (PIC) = 0.35 in 28 mainly German barley cultivars and two H. spontaneum accessions.
Type	SSR
PCR primers	ACCCCAAAAAGAAAGGAG ATTAGAGGGAAGGGGATG Left 5' TGAAACCAGGAAGTTTGGATGTTG Right 5' GAGCAATGCCACAGGAGTCG
SSR size	190
Amplification Conditions	Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence	X83518
Source Gene Class	Hooded/elevated hooded/awned lemma
Source Gene	Kap (Hordeum)
Source Allele	Kap (Hordeum) kap (Hordeum)
Source Species	Hordeum vulgare