Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC02972_L01R01

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC02972_L01R01  [ Marker Report ]
Locus	scsnp02972
Data at Germinate	ABC02972
Data at PLEXdb	Barley1_02972
General Remarks	Estimated product size = 191 BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc02972
Type	STS
PCR primers	5' GAGAGACCGAGCGAGGAAAT 5' CTTCTTGGTGGTGTCGATCTC
Sequence	Barley1_02972
Source Species	Hordeum vulgare