Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: sb978

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	sb978
Locus	sb978
Reference	De Koeyer DL et al. (2004) A molecular linkage map with associated QTLs from a hulless x covered spring oat population Theoretical and Applied Genetics 108:1285-1298.
General Remarks	Derived from barley cDNA clone bcd978
Type	PCR
PCR primers	sb978f1 = AAGGTCAGCCAGGTCAAATG sb978r1 = CGAGATAACCTCCCTCCCTC