Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC03381_L01R01

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC03381_L01R01  [ Marker Report ]
Locus	scssr03381
Data at Germinate	ABC03381
Data at PLEXdb	Barley1_03381
General Remarks	Estimated product size = 162 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc03381
PCR primers	5' CAGGGACGTACAATATTACCG 5' AATAAGCAGGGTACCTTTTGG
Sequence	Barley1_03381
Source Species	Hordeum vulgare