Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABC03612_L01R01

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABC03612_L01R01  [ Marker Report ]
Locus	scsnp03612
Data at Germinate	ABC03612
Data at PLEXdb	Barley1_03612
General Remarks	Estimated product size = unknown BarleySNP type = SNP From Contig Technology platform used = ABI3700 Sequencing Affymetrix contig name = abc03612
Type	STS
PCR primers	5' TCTCCAGACCGGTAAAGGAA 5' AGGAGGCACAAGCAGAAGAA
Sequence	Barley1_03612
Source Species	Hordeum vulgare