GrainGenes Probe Report: MWG911B
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
Probe
MWG911B [ Marker Report ]
Locus
MWG911B
Reference
General Remarks
Restriction Enzyme for CAPS marker is FnuD II; HpyCH4 IV
PCR primers
5' atggtgcagctgggtgatg 3'
5' tctccgagcgtgtctactgtc 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 63 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare
GrainGenes Probe Report: MWG911B
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
|
| ||
|
| ||
| |||
|
| ||
|
| ||
|
| ||
|
|
