Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG967

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG967  [ Marker Report ]
Locus	Xmwg967-1D [ Show all 8 ]
Synonym	Synonym HAR35_6809
Type	Genomic STS
STS primers	5' GCGACGGGCAGCAAGAAAAA 5' CTGAGGGCCAGTGGGATCTT
STS size	171
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234684 AJ234683 MWG967-5 MWG967-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare