Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG2138

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG2138  [ Marker Report ]
Locus	Xmwg2138-3 [ Show all 6 ]
Type	Genomic STS
STS primers	5' CGAGGCTGTGCGGCACGAAG 5' GGTCTGCCCCGTCTGGATCG
STS size	379
Amplification Conditions	STS annealing temperature 65-67 oC
Sequence	AJ234800 AJ234799 MWG2138-5 MWG2138-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare