Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: MWG2158

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	MWG2158  [ Marker Report ]
Locus	MWG2158 HD057D7 HD074E21 Xmwg2158-3A
Synonym	Synonym HAR35_21052
Type	Genomic STS
STS primers	5' CTGAAGCCAATGGGCTAGAA 5' GTGATAGCACCTCGGTCACA
STS size	ca. 1000
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	AJ234810 AJ234809 MWG2158-5 MWG2158-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare