Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: pTtksuF41

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	pTtksuF41  [ Marker Report ]
Locus	XksuF41-2 [ Show all 13 ]
Type	Genomic STS
PCR primers	R:TCTCCTAGCATAGCAGATGG L:AGTCGTGTCGACTCGTCCAA
Polymorphism	KSUF41 EcoRV [ Show all 6 ]
Linkage Group	2D / 2D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.9